I don't plan on (and well, it's probably biologically a little late now) having children, but I'm still tempted to buy a set of these ABC cards. Seriously: "N is for Neuron." I love that.

So, I broke down and ordered Making Mathematics with Needlework, which I'd been looking at for a while. It came yesterday.

I didn't have a lot of time to look at it - last night was the AAUW meeting (and I have to say: I'm NOT president for next year! Whoo! [I was president for three terms, mainly because no one else wanted to do it, but I told them this year I was NOT doing it again.] My limited experiences with "power" tell me that it's mostly a lot of keep-you-up-at-night worries and responsibilities, and very little "gravy." I have utterly no interest in running for office. Which, if I read my Plato right, means I'm probably the best-suited person in the U.S. to be president right now...)

Anyway. I didn't quite know what to expect from the book when I ordered it. I was surprised when I opened it up and looked at it.

First, it reads very much like any other scholarly book. (And therefore, not like most needlecraft books). It has chapters, and the chapters are broken down into subchapters - 3.1, 3.2, and so on. Just like the stats book I teach from!

Also: it is the only needlework book I remember seeing that has extensive footnotes and a literature cited section for every chapter.

Second, it's VERY high-level math. At least from what I looked at. I'm actually going to have to sit down and READ the chapters (rather than skim) and probably refer to some online references or what math background books I have. It looks like it's just right at the outer limits (and maybe in some cases, beyond) my understanding.

There's some topology (there's a moebius-band quilt and a knitted torus (Mmmm, torii!) and something called Fortunatus' Purse). There are also some geometry/symmetry topics (a chapter on symmetry in cross-stitch patterns).

The two chapters that immediately appealed to me were the one on a formula for picking up stitches on a knit garment (which involves a consideration of something called Diophantine equations, which, if I'd heard of them before, I'd forgotten them) and algebra and pattern-knitting, with an emphasis on socks.

Now, this is a very specialized sort of algebra. Plumbing the dim mists of my memory, of the year that Ms. Lawrence suffered through having me in her 8th grade algebra class (and yes, I think it's that, rather than the other way around, considering the volume of complaining and not-paying-attention I did in that class) and also Ms. Pruyne's Algebra II class, I do not remember this kind of algebra.

The algebraic socks basically talk about fitting a pattern of a certain repeat length into a spiral of a certain, different, repeat length - basically, a complex way of figuring out how to shape a sock that has colorwork without messing up the colorwork.

But it's more than that. The authors discuss modulo arithmetic. (Basically, it's a form of "clock face like" arithmetic where you're working circularly - just like on a sock - and you have to figure out the fitting of the "minutes" into the "hour" on the clock face.

That's about all of it I can explain. I'm going to have to read more about it before I feel like I can begin to grasp what the authors are writing about. (And I feel like I should be able to grasp it - after all, knitting-in-the-round is something I've done for YEARS and so if I can visualize what's happening on the leg of a sock, I should be able to sort of mentally plug the symbols into what's happening and figure it out).

I also just LIKE the word "modulo;" it sounds like something that belongs in Harry Potter-world. (Oooh, and modulos have to do with casting out nines, which is another mystical-magical sounding mathematical thing.

And this makes me think of a quotation from Arthur C. Clarke (who passed on last week): "any sufficiently advanced technology is indistinguishable from magic."

Well, mathematics may not be a particularly advanced technology (at least not in the sense of containing lots of silicon and requiring wiring to make it work), but some of the more arcane bits of it do seem kind of "magic" to me.

I remember last summer reading a book - I think it was called "Pi in the Sky"? - about the history of mathematics. (I bogged down about 3/4 through when they got into a long disquisition on how weird Godel was). One of the topics addressed was: "Is mathematics something humans discovered or something humans invented?"

That thought gives me a bit of a chill down my spine.

I honestly, seriously, truly hope the correct answer is "discovered." Because I want to believe that there's an underlying order to things that can be described and explained; that the universe basically makes "sense."

(And yes, I realize that my fondness for the concepts of quantum mechanics kind of goes against that idea...but - consistency. hobgoblin. small minds.)

(And I'm also reminded of a Piled Higher and Deeper online comic from a while back - where the young astrophysicist talked about wanting to believe that there's a Theory of Everything, because "It's gotta be beautiful all the way down.")

But the thought that mathematics, all the patterns we see, just being a human invention - just being some kind of aberration of minds shaped by centuries of being benefitted by seeing pattern - I find that really unsettling.

(I guess in some respects I am a bit of a Platonist; darn it, I want those ideal forms to be out there.)

And also, I have to admit, one of my deeply held hopes is that after I shuffle off this mortal coil, one of the first things that happens in the Great Beyond is that someone takes me aside - it matters not whether it's an angel or the shade of Newton or Galileo or some lesser-known individual - and says to me, "I know all your life you've been longing to know how everything really worked. Now, I'm going to tell you!"

So the idea that mathematics - even mathematics I don't fully understand - can help us understand how things work is an idea I cherish pretty deeply, and I don't want to contemplate (well, not without some really, really good proof beyond a lot of handwaving and appeals to emotion) the concept that it might be purely a human invention.

Your Name In DNA (or RNA, as the case may be).

(All the amino acids are given a letter code, so you can figure out your code from the letters in your name. Not all alphabet letters are used because there are only 20 amino acids plus X for the stop codon, so you might have to get creative. Not as creative as trying to translate your name into "Hawaiian" like they do in the tourist shops though.)

My given name is GAACGUAUAUGUGCU. That's a lot of Us.

My nom (nom nom nom) de plume is UUUAUUCUUCUUUAUUUUUUAUAAUAAA (well, I had to fiddle with the spelling a bit and sort of pseudo-Scandanavianize it as there was no j and no o - so I used another f and a y instead.)

I will leave it as an Exercise To The Reader to translate into DNA (if you were back-coding to DNA, the G would become C, the C would become G, the U would become A and the A would become T) because staring at those things too long makes me go crosseyed.

Someone made a pair of socks featuring Planck's constant.

That makes me want to consider more science-geek type socks. Maybe a pair of pi-striped socks, like my pi hat. Or, I don't know, socks that somehow capture some of the ideas of quantum mechanics.

I still have the idea for a quark scarf hibernating in my head - even have the yarn for it. (Black for the background, red, green and blue for decorations on the scarf, because one of the designators given to quarks is "color" - not a literal color, of course, but convenient names assigned to properties that apparently have no analog in the macroscale world). I keep thinking it will be some kind of an intarsia pattern - small boxes of color on the black background - but, unless I double the scarf (and it's aran-weight yarn I intended to use for it, which would make for a heavy scarf), I'm not sure how to make the back neat enough to be presentable on something like a scarf, where the reverse side will be seen.

I also toyed with the idea of making the colors into "bobbles" which I have to admit pleases me, but I hate doing bobbles.

Perhaps what I'll wind up doing is some kind of broken-stripe thing, carrying the colors so it's like a Fair Isle design, and just abandon the idea of having more than one "quark" color per row.

Thank you for the lovely comments on Hiawatha. As I said, it's the most complex (and largest!) thing I've ever knit. I'm awarding myself a virtual "Knitter's Merit Badge" for that one.

****

Today I'm going to talk a bit about books I personally find inspirational. Most of you are aware I'm a child of the 70s. I grew up in a small town in northeast Ohio. I first started doing crafts (and really being aware of the library) probably about 1975-76 or so (And the Bicentennial didn't hurt; don't forget that there was a big wave of Americana-fashion, including handcraft, at that time).

When I was a kid, we took weekly (sometimes twice weekly, in the summer) trips to the library. While I hewed pretty close to the kids' shelves when it came to fiction (and my first foray into "adult" fiction, at 13, was pretty startling: I inadvertently picked a book with fairly graphic sex scenes, and although I knew the mechanics of "baby making" at that point in time, I really wasn't ready yet to contemplate the idea that it was something people did for fun. [I was a pretty innocent and sheltered child, I realize now, considering that there ARE 13 year old girls who have babies...] I was, at least temporarily, driven back to the likes of the Chronicles of Narnia, which were safe in that respect.)

Anyway. I did spend a lot of time in the "grown up" crafts section, because although there were some good books in the kids' section (I remember in particular, "Steven Caney's Kid's America" which was a wonderful gallimaufry of things, ranging from how to make corn dogs to the rudiments of handwriting analysis), it was smaller than the adult section and in some respects my interests and skills had passed beyond play-doh and paper things.

I remember summers as a kid; we didn't have air conditioning (except in my parents' bedroom;; my father was prone to migraines in those days and sometimes he needed the a/c. On rare occasions, when it was very hot at night, my parents would let my brother and me "camp out" on the floor in their room with the a/c running.) Most of the time we got by with open windows (this was Northeast Ohio in the 70s, which are now considered one of the cooler-temperature decades, at least in recent years). When it got really hot my mom and brother and I would go and hang out in the basement (my father would either be teaching summer classes - in an air-conditioned building - or he'd be at field camp, in the mountains out West). I remember taking books from the library down there and reading them or doing crafts from them, or going through my mom's impressive stash of craft and women's magazines (back in those days, you could pretty well count on Women's Day or Family Circle having a craft project or two; the Easter and Christmas issues often had many).

Remember that this was the 1970s. The first "new wave" of crafts - sort of a hangover of the Hippie era and also a strong dose of back-to-the-land/Little-House-on-the-Prairie/Americana movement.

I still have a soft spot for the books of that era. They were among the first craft books I remember reading.



I've tried to accumulate copies of the ones I remember. I have four of them - both the Woodstock Craftsman's Manuals (which are also a great period-piece read as well - I can almost smell the patchouli), "Handmade Toys and Games" by Jean Ray Laury, and one of Ann Wiseman's "Making Things" books (she had at least two; I've only found the one).

There were others, I know...there was a small book of decorated toys and dolls (heavily embroidered) by a British writer (it was NOT Erica Wilson, and it was also NOT the Winsome Douglass book that Dover reprinted). And Jean Ray Laury also had a book of dolls - mostly just photographs but some interviews with the dollmakers.

I loved these books. I particularly loved the chapters on Quiltmaking and Needlepoint in the Craftsman's Manual 2 (I never saw 1 until I bought it as an adult; for some reason my public library had only the second volume). These two chapters had the same author: Carol W. Abrams.

I kind of wonder what became of her. I think it would be fun to sit down and "rap" (in the 1970s sense) with her; she seems a bit of a kindred spirit to me.

She also wrote the chapter on Embroidery in the first Craftsman's Manual.

Remember what I was talking about with Robert Farrar Capon's discussion of appreciating the created world because of its "glorious unnecessary-ness"? Well, Abrams has a similar attitude, about threads:

"The colors! The textures are indescribable - smooth shiny silks, nubbly synthetics, metallics, cotton flosses, yarns in wools and blends in a good variety of weights, tapestry wools, crewels in earthy shades. Touch them, smell them, rub them against your face, lay them next to one another. Revel in their presence, their substance.

(emphasis mine).

Almost exactly the same thing: rejoice in the joys of creation.

I could never quite understand the theology - and I once attended a church where this seemed to be the preacher's intent - that said that the whole world was evil and bad and not worthy of our consideration because of human sin. I greatly prefer Capon's (perhaps heterodox) theology that suggests that sinfulness is not so much Deliberate Evil as it is a weakness, and that we are called to be co-redeemers of the world by loving it and wishing it were perfect. Not rejecting it. Not pining for something better - pie in the sky bye and bye when we die - but loving it here and now but acknowledging its imperfection and hoping for something better for it.

(I finished "Supper of the Lamb" yesterday. I will say it is as much a book of Christian theology as it is about cooking, so if you find that off-putting, it may not be for you. But it made me think, a lot, and I carried the bits and pieces of it I read around in my head each day and thought about them more. And for me, that's the mark of a good book - if I'm thinking about it at times when I'm not actively reading it).

Anyway - a lot of these 70s craft manuals are not pattern-by-pattern, stitch-by-stitch guides. They are more "here is how you do the basics of this thing, now go and do it, peace be with you." There's also somewhat of an anti-consumerist ethos in a lot of the books - you make things out of stuff that might be discarded (Wiseman is very good at this - recycling or asking for stuff like fruit crates that might otherwise be discarded). There's no direction telling you you need 18 skeins of Fabu-Fiber silk-and-wool topspun; instead, they say "use a worsted weight if you're a beginner, or soft string" (that's from the chapter on Crochet). Or they show finished creations and give a thumbnail of how to make them.

It seems, almost, there's more of an assumption that people were self-reliant, that they could figure stuff out on their own. Maybe even that "patterns were for squares" (though I hope not; I hate the whole "blind follower vs. innovator" dichotomy; it seems to say that some crafters are "more equal" than others).

I particularly loved the Handmade Toys book and was very happy to find my own copy, used. I remember first making sock dolls as a kid after seeing them in this book. And I was inspired to make my own toy mice after seeing the picture (on page 69 of my copy) of toy mice, "dancing the stately minuet." (I mean - how can you resist? I couldn't, as an eight-year-old girl).

(I see there are even some proto-amugurimi in this book: a toy cat almost like the "Chessie" advertising symbol, and a very Eeyore-like donkey made by a 10 year old girl. And that's another thing I loved about the book, as a kid: they showed what other kids had made. It was very freeing, it was like, "Look - what you can do is good, too! You don't have to be a grown-up to make this stuff!")

some bloggers seem to view these books a bit derisively. I cannot bring myself to feel anything but affection for them - these are the books that nurtured me into craft.

They are also SO earnest. I can't help but love the earnestness, the idealism - the sense that the bad old world would be less so if people made more and consumed less, if people took time to enjoy the created world, if people developed skills, if people spent time in quiet communion with their own personal muse.

It's probably because, deep down, I AM that earnest and idealistic. I do tend to think that creating - whether it's with yarn or fabric or paint or words or musical notes or food or wood or leather or whatever - is an important part of being, and something that centers us and makes us understand and appreciate. And that in a way, it's a sort of celebration of the world around us - a celebration of the created world and that which is good in it. (And I've also read some theologians write that in creation, the human is closest to the Divine - because creation is the occupation of the Divine.).

And so, from time to time, I pull these books off the shelf. They are good to look at because they help remind me of a time when I had what's sometimes known as "beginner's mind" - when I wasn't so hung up on perfection and it was more the joy of creating, of tasting and feeling and getting into the full sensory experience of the materials and what I was doing with them, rather than the finished project, that mattered. And also a time when I was less pattern-bound, less practical. And it also reminds me of the cool, dampish basement, with the washer and dryer and the boxes of fabric and yarn that my mom would sometimes let me dig through and pick things out of to craft with. And the train table (my father was, briefly, into HO-gauge trains and we had a whole big table for them.). And the cast-off toys that were stored down there - I used to sometimes secretly visit the ones I had technically "outgrown."

And as my "summer vacation" (such as it is) begins, it's interesting to look at these books again and think of the summers of my childhood.


What books do YOU find inspirational, in terms of craft or creating?

For the love of Pi:

pi10k is a neat site where you assign 10 musical notes (one to each digit, 0 though 9) and it plays them as a tune to the order of the first 10,000 digits in pi.

wearing your pi hat while you do this is optional.

Someone, somewhere, should compile all the uses of pi (and phi, and e) in art and entertainment and all of that. I think it would be interesting.

****

And another link.

Those of you who read the blog regularly know I am a fan of Teh Cute (tm). Well, here's another site, much in the spirit of Cute Overload:

The Random Kitten Generator.

Does what it says: randomly selects a picture of a kitten for you. You can press a button for another picture. Keep doing that until your sense of equilibrium is restored, or before you go into a "aawwwww" induced coma. (There is an ad on the page but at least it's not loud and you can kind of ignore it)

Another silly idea that's batting around in my head:

Bacteriophage socks.

No, not socks for bacteriophages (they don't have feet), but socks decorated with a bacteriophage-like pattern.

Why? Well, I think bacteriophages are kind of cool. Both because of their use in discovering that DNA was the material of biological inheritance, and their function (attacking bacteria). And also, they just look cool. (Like this image here. Or here. Or how they pack together to give a honeycomb like pattern.

I'm seeing it as a small discreet band of Fair Isle bacteriophages knit just under the cuff - you know, so most people don't know they're there. I'm envisioning maybe red 'phages on dark blue socks, or tan, or something like that. (When I finish the Miranda socks - which I am working on some lately - I will have a small amount of red left over, certainly enough to work a band of 'phages into a pair of socks)

I don't know if I'll ever work it up...but the idea still pleases me.