Your Name In DNA (or RNA, as the case may be).

(All the amino acids are given a letter code, so you can figure out your code from the letters in your name. Not all alphabet letters are used because there are only 20 amino acids plus X for the stop codon, so you might have to get creative. Not as creative as trying to translate your name into "Hawaiian" like they do in the tourist shops though.)

My given name is GAACGUAUAUGUGCU. That's a lot of Us.

My nom (nom nom nom) de plume is UUUAUUCUUCUUUAUUUUUUAUAAUAAA (well, I had to fiddle with the spelling a bit and sort of pseudo-Scandanavianize it as there was no j and no o - so I used another f and a y instead.)

I will leave it as an Exercise To The Reader to translate into DNA (if you were back-coding to DNA, the G would become C, the C would become G, the U would become A and the A would become T) because staring at those things too long makes me go crosseyed.